CapsID

An automated CAPS marker based genotyping system.

To perform an analysis please proceed to the Input Form.

What is a CAPS Marker?

A location within a homologoulous sequences of DNA from one or more different sources in which suttle differences in DNA structure cause a restriction enzyme to cut differently is called a differential cutsite. For example the enzyme EcoRI cuts sequences with the GAATTC recognition site. So if species A has a gene G while species B has a similair gene G' then we may have the situation in which a portion of G lined up against a portion of G' looks like

Species A: ACGTTAAAGAGAATTCATAGATCGGCG
Identity : |||||||||||| ||||||||||||||
Species B: ACGTTAAAGAGATTTCATAGATCGGCG

The enzyme EcoRI cuts the red string but does not cut the blue string. Thus the sequence from Species A is cut into two peices while the sequence from Species B remains intact. If we first amplify these sequences using PCR, then digest them with the enzyme EcoRI we can run the digested product on an agarose gel to observe that there are indeed two fragments for Species A and one for Species B. Thus, a CAPS marker is a differential cutsite along with the primer pair needed to amplify the sequences to observable quantities via PCR.

How can I use CapsID to genotype a sample species?

CapsID is useful if you have a good idea of what species your sample is but want to know more specifically. For example, if your sample is a blowfly and believe there are only 20 species of blowfly that it might be, you could choose a gene (or gener fragment ~ 300bp) that is common to most blowflys and relatively conserved(or most species in general) such as ribosomal DNA. The gene's sequence should be publically available for all 20 possible species. You can then align the sequences and give the alignment to CapsID. CapsID will design the set of CAPS markers that will give the best guess as to which species your sample is when the CAPS are tested on your sample.